Skip to content
Open
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
Original file line number Diff line number Diff line change
Expand Up @@ -38,6 +38,7 @@
import java.nio.file.Path;
import java.util.Iterator;


/**
* @author Daniel Gomez-Sanchez (magicDGS)
*/
Expand Down Expand Up @@ -146,6 +147,55 @@ protected static void sanityCheckDictionaryAgainstIndex(final String fastaFile,
}
}

/** Do some basic checking to make sure the fasta and the index match.
* <p>
* checks that the length of the fasta file is at least as long as the index proclaims
* and that beyond the last position references in the index there is only one line followed by whitespaces
*
* @param fastaFile Path to fasta file
* @param fastaSequenceIndexes index file to check against the fasta file.
*
* @throws IOException in case of io-error when reading fastaFile
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

This should say what it throws if it detects and error.

*/
public void sanityCheckFastaAgainstIndex(final Path fastaFile,
final FastaSequenceIndex fastaSequenceIndexes) throws IOException {

final FastaSequenceIndexEntry lastSequenceIndex = fastaSequenceIndexes.getIndexEntry(fastaSequenceIndexes.getLastSequence());

final long lastSequenceLength = lastSequenceIndex.getSize();
final long lastSequenceStart = lastSequenceIndex.getLocation();
final long lastSequenceEnd = lastSequenceStart + lastSequenceIndex.getOffset(lastSequenceLength);

final long fastaLength = Files.size(fastaFile);

if (lastSequenceEnd > fastaLength) {
throw new IllegalArgumentException("The fasta file (%s) is shorter (%d) than its index (%s) claims (%d). Please reindex the fasta.".formatted(fastaFile.toUri().toString(),fastaLength, index.toString(), lastSequenceEnd));
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

IllegalArgument seems like the wrong exception here. I might declare a new IncompatibleIndexException or something like that, it would make it easier for calling code to deal with this. If for example someone wanted to automatically reindex on a failure.

}
// if fasta file is longer than this, make sure that the remainder is just whitespaces
long posOfInterest = lastSequenceEnd + lastSequenceIndex.getTerminatorLength();
if (posOfInterest < fastaLength) {

final ByteBuffer channelBuffer = ByteBuffer.allocate(100);

while (posOfInterest < fastaLength) {
channelBuffer.clear();
readFromPosition(channelBuffer, posOfInterest);
for (int i = 0; i < channelBuffer.position(); i++) {
byte b = channelBuffer.get(i);
if (!Character.isWhitespace((char) b)) {
throw new IllegalArgumentException(
("The fasta file %s is too long (relative to the index). In particular has a non-whitespace " +
"character (%c) at a position (%d) beyond the last base (%d), according to its index (%s)." +
" Please reindex the fasta.")
.formatted(fastaFile.toUri().toString(), (char) b, posOfInterest + i, lastSequenceEnd,index.toString()));
}
}
posOfInterest += channelBuffer.limit();
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I think there might be minor bug here. When you clear the buffer it should set limit = capacity, but I don't think readFromPosition guarantees that the as many bytes as possible are read, it's possible for it to return fewer than requested. I think this might have the effect of skipping parts of the fasta file on incomplete reads.

Setting it with position or capturing the return value from readFromPosition would both do the right thing I think.

Unlikely to be a real issue since the bug would be to sometimes fail to detect a mismatch if there are characters embedded partway through a block of white space.

}
}
}


public FastaSequenceIndex getIndex() {
return index;
}
Expand Down Expand Up @@ -210,11 +260,12 @@ public ReferenceSequence getSubsequenceAt( String contig, long start, long stop
final int bytesPerLine = indexEntry.getBytesPerLine();
final int terminatorLength = bytesPerLine - basesPerLine;

long startOffset = ((start-1)/basesPerLine)*bytesPerLine + (start-1)%basesPerLine;
long startOffset = indexEntry.getOffset(start);

// Cast to long so the second argument cannot overflow a signed integer.
final long minBufferSize = Math.min((long) Defaults.NON_ZERO_BUFFER_SIZE, (long)(length / basesPerLine + 2) * (long)bytesPerLine);
if (minBufferSize > Integer.MAX_VALUE) throw new SAMException("Buffer is too large: " + minBufferSize);

// Allocate a buffer for reading in sequence data.
final ByteBuffer channelBuffer = ByteBuffer.allocate((int)minBufferSize);

Expand Down
47 changes: 32 additions & 15 deletions src/main/java/htsjdk/samtools/reference/FastaSequenceIndex.java
Original file line number Diff line number Diff line change
Expand Up @@ -36,11 +36,7 @@
import java.io.PrintStream;
import java.nio.file.Files;
import java.nio.file.Path;
import java.util.Iterator;
import java.util.LinkedHashMap;
import java.util.Map;
import java.util.Objects;
import java.util.Scanner;
import java.util.*;
import java.util.regex.MatchResult;

/**
Expand All @@ -50,26 +46,31 @@ public class FastaSequenceIndex implements Iterable<FastaSequenceIndexEntry> {
/**
* Store the entries. Use a LinkedHashMap for consistent iteration in insertion order.
*/
private final Map<String,FastaSequenceIndexEntry> sequenceEntries = new LinkedHashMap<String,FastaSequenceIndexEntry>();
private final Map<String, FastaSequenceIndexEntry> sequenceEntries = new LinkedHashMap<>();

/** this member contains the name of the last index entry that was created during initialization.
* Afterwards, subsequent operations (such as rename) might change the names and thus this member becomes unreliable.
*/
private final String lastSequence;

/**
* Build a sequence index from the specified file.
* @param indexFile File to open.
* @throws FileNotFoundException if the index file cannot be found.
* @throws SAMException if the index file cannot be found.
*/
public FastaSequenceIndex( File indexFile ) {
public FastaSequenceIndex( File indexFile ) throws SAMException {
this(IOUtil.toPath(indexFile));
}

/**
* Build a sequence index from the specified file.
* @param indexFile File to open.
* @throws FileNotFoundException if the index file cannot be found.
* @throws SAMException if the index file cannot be found.
*/
public FastaSequenceIndex( Path indexFile ) {
public FastaSequenceIndex( Path indexFile ) throws SAMException {
IOUtil.assertFileIsReadable(indexFile);
try (InputStream in = Files.newInputStream(indexFile)) {
parseIndexFile(in);
this.lastSequence = parseIndexFile(in);
} catch (IOException e) {
throw new SAMException("Fasta index file could not be opened: " + indexFile, e);
}
Expand All @@ -80,13 +81,15 @@ public FastaSequenceIndex( Path indexFile ) {
* @param in InputStream to read from.
*/
public FastaSequenceIndex(InputStream in) {
parseIndexFile(in);
lastSequence=parseIndexFile(in);
}

/**
* Empty, protected constructor for unit testing.
* Empty, protected constructor for unit testing. Use with care, lastSequence will be incorrect.
*/
protected FastaSequenceIndex() {}
protected FastaSequenceIndex() {
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I wonder if this is really only used for unit testing.

lastSequence = "";
}

/**
* Add a new index entry to the list. Protected for unit testing.
Expand Down Expand Up @@ -144,10 +147,13 @@ public int hashCode() {
/**
* Parse the contents of an index file, caching the results internally.
* @param in InputStream to parse.
*
* @return the name of the last contig (for the sanity-check)
*/
private void parseIndexFile(InputStream in) {
private String parseIndexFile(InputStream in) {
try (Scanner scanner = new Scanner(in)) {
int sequenceIndex = 0;
String lastContig = null;
while( scanner.hasNext() ) {
// Tokenize and validate the index line.
String result = scanner.findInLine("(.+)\\t+(\\d+)\\s+(\\d+)\\s+(\\d+)\\s+(\\d+)");
Expand All @@ -170,7 +176,9 @@ private void parseIndexFile(InputStream in) {
contig = SAMSequenceRecord.truncateSequenceName(contig);
// Build sequence structure
add(new FastaSequenceIndexEntry(contig,location,size,basesPerLine,bytesPerLine, sequenceIndex++) );
lastContig=contig;
}
return lastContig;
}
}

Expand Down Expand Up @@ -233,4 +241,13 @@ public Iterator<FastaSequenceIndexEntry> iterator() {
public int size() {
return sequenceEntries.size();
}


/**
* @return The name of the last entry that was added when parsing the index file. Only guarranteed to be correct just
* after initialization. Protected for access from AbstractIndexedFastaSequenceFile.
*/
protected String getLastSequence() {
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I don't love this with the caveats but it's fine if it's clearly labelled.

return this.lastSequence;
}
}
Original file line number Diff line number Diff line change
Expand Up @@ -112,6 +112,26 @@ public int getSequenceIndex() {
return sequenceIndex;
}

/** Return the offset to pos as determined by the number of bases and bytes per line
*
* @param pos the (1-based) position in the contig that is requested
* @return the offset (0-based) from 'location' where pos is located in the file.
*/
public long getOffset(long pos) {
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

👍

final int basesPerLine = this.getBasesPerLine();
final int bytesPerLine = this.getBytesPerLine();

return ((pos - 1) / basesPerLine) * bytesPerLine + ((pos - 1) % basesPerLine);
}

/** get the terminator length from the bytes per line and the bases per line
*
* @return the length of the terminator of each line (1 or 2)
*/
public int getTerminatorLength() {
return bytesPerLine - basesPerLine;
}

/**
* For debugging. Emit the contents of each contig line.
* @return A string representation of the contig line.
Expand Down
Original file line number Diff line number Diff line change
Expand Up @@ -81,6 +81,7 @@ public IndexedFastaSequenceFile(final Path path, final FastaSequenceIndex index)
throw new SAMException("Indexed block-compressed FASTA file cannot be handled: " + path);
}
this.channel = Files.newByteChannel(path);
sanityCheckFastaAgainstIndex(path,index);
} catch (IOException e) {
throw new SAMException("FASTA file should be readable but is not: " + path, e);
}
Expand Down
Original file line number Diff line number Diff line change
Expand Up @@ -60,6 +60,11 @@ public class AbstractIndexedFastaSequenceFileTest extends HtsjdkTest {
private static final File SEQUENCE_FILE_BGZ = new File(TEST_DATA_DIR,"Homo_sapiens_assembly18.trimmed.fasta.gz");
private static final File SEQUENCE_FILE_GZI = new File(TEST_DATA_DIR,"Homo_sapiens_assembly18.trimmed.fasta.gz.gzi");
private static final File SEQUENCE_FILE_NODICT = new File(TEST_DATA_DIR,"Homo_sapiens_assembly18.trimmed.nodict.fasta");
private static final Path HEADER_WITH_WHITESPACE = new File(TEST_DATA_DIR,"header_with_white_space.fasta").toPath();
private static final Path HEADER_WITH_EXTRA_WHITESPACE = new File(TEST_DATA_DIR,"header_with_extra_white_space.fasta").toPath();
private static final Path CRLF = new File(TEST_DATA_DIR,"crlf.fasta").toPath();
private static final Path HEADER_WITH_WHITESPACE_index = AbstractIndexedFastaSequenceFile.findFastaIndex(HEADER_WITH_WHITESPACE);
private static final Path CRLF_index = AbstractIndexedFastaSequenceFile.findFastaIndex(CRLF);

private final String firstBasesOfChrM = "GATCACAGGTCTATCACCCT";
private final String extendedBasesOfChrM = "GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT" +
Expand All @@ -68,6 +73,15 @@ public class AbstractIndexedFastaSequenceFileTest extends HtsjdkTest {
private final String lastBasesOfChr20 = "ttgtctgatgctcatattgt";
private final int CHR20_LENGTH = 1000000;

@DataProvider(name="mismatched_indexes")
public Object[][] provideMismatchedIndexes() {
return new Object[][]{
new Object[]{HEADER_WITH_WHITESPACE,CRLF_index},
new Object[]{CRLF,HEADER_WITH_WHITESPACE_index}
};
}


@DataProvider(name="homosapiens")
public Object[][] provideSequenceFile() throws FileNotFoundException {
return new Object[][] { new Object[]
Expand Down Expand Up @@ -470,4 +484,24 @@ public void testBlockCompressedIndexedFastaSequenceFileFromNio() throws IOExcept
}
}

@Test(expectedExceptions = IllegalArgumentException.class,
dataProvider = "mismatched_indexes")
public void testWrongIndex(Path fasta, Path index) {
try (IndexedFastaSequenceFile indexedFastaSequenceFile = new IndexedFastaSequenceFile(fasta, new FastaSequenceIndex(index))) {

} catch (IOException e) {
throw new RuntimeException(e);
}
}

@Test
public void testExtraWhitespace() {
try (IndexedFastaSequenceFile indexedFastaSequenceFile =
new IndexedFastaSequenceFile(HEADER_WITH_EXTRA_WHITESPACE,
new FastaSequenceIndex(HEADER_WITH_WHITESPACE_index))) {

} catch (IOException e) {
throw new RuntimeException(e);
}
}
}
Original file line number Diff line number Diff line change
@@ -0,0 +1,7 @@
>a test white space
ACTG
>b test whitespace
ACTG



Loading