diff --git a/Hash Table/C++/Repeated DNA Sequences.cpp b/Hash Table/C++/Repeated DNA Sequences.cpp
deleted file mode 100644
index 82be182..0000000
--- a/Hash Table/C++/Repeated DNA Sequences.cpp	
+++ /dev/null
@@ -1,67 +0,0 @@
-/*Algorithm: 
-We will store each unique DNA sequence and its frequency in map by traversing from index 0. At last we will return all the
-unique DNA sequence which are repeated by traversing map .
-*/
-
-#include <bits/stdc++.h>
-using namespace std;
-
-class Solution {
-public:
-    vector<string> findRepeatedDnaSequences(string s) {
-        
-        unordered_map<string,int>m;
-        vector<string>ans;
-        
-        int n=s.length();
-        
-        for(int i=0;i<=(n-10);i++)
-        {
-            m[s.substr(i,10)]++; //storing string and its frequency of length 10
-        }
-        
-        for(auto x:m) //traversing map
-        {
-            if(x.second>1) //DNA is repeated
-                ans.push_back(x.first); 
-                
-        }
-        
-        return ans;
-        
-    }
-};
-
-
-int main() 
-{
-   
-    string s;
-    cin>>s;
-
-    Solution obj;
-    vector<string>ans=obj.findRepeatedDnaSequences(s);
-
-    for(int i=0;i<ans.size();i++)
-        cout<<ans[i]<<" ";
-       
-    return 0;
-}
-
-// Time Complexity : O(N)
-// Space Complexity : O(1)
-
-/*
-TestCase 1:
-Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
-Output: ["AAAAACCCCC","CCCCCAAAAA"]
-Explaination: DNA sequence AAAAACCCCC and CCCCCAAAAA both of length 10 are repeating 2 times ,
-rest all sequences are present only once.
- 
-
-TestCase 2:
-Input: s = "AAAAAAAAAAAAA"
-Output: ["AAAAAAAAAA"]
-Explaination: DNA sequence AAAAAAAAAA of length is repeating 4 times, rest all sequences are present only once.
-
-*/
\ No newline at end of file